A Novel Polymerase γ Mutation in a Family With Ophthalmoplegia, Neuropathy, and Parkinsonism FREE

Mutations in 3 nuclear genes, adenine nucleotide translocator-1 (ANT1), chromosome 10 open reading frame 2 (C10orf2) encoding Twinkle helicase, and polymerase γ (POLG), have been associated with autosomal progressive external ophthalmoplegia (PEO) and multiple deletions in mitochondrial DNA (mtDNA).¹ Mutations in POLG cause heterogeneous and usually severe clinical phenotypes and may be associated with either dominant or recessive PEO.^{2 - 8} In addition to PEO, common manifestations of POLG mutations include neuropathy, ataxia, hypogonadism, migraine, hearing loss, muscle weakness, and psychiatric symptoms. Extrapyramidal signs are rarely associated with primary mtDNA mutations and have not been reported in patients with POLG mutations.

We describe a family in which parkinsonism was a prominent manifestation together with PEO. The syndrome was caused by a novel POLG mutation, suggesting that the dopaminergic nigrostriatal system can be a target of mitochondrial dysfunction. 

The proband (case III-1) (Figure 1), a 49-year-old woman, noticed progressive bilateral ptosis and diplopia from the age of 28 years. She also complained of weakness in both arms and legs and of exercise intolerance. A neurological examination at 44 years of age showed nearly complete ophthalmoplegia, severe bilateral ptosis, and mild weakness of neck flexion. Results of a needle electromyogram in the limb muscle were normal. Results of a fundoscopic examination and the patient’s hearing were normal. At 45 years of age, she was found to have sensory neuropathy. There was decreased vibratory sensation in the toes and decreased pinprick sensation below the ankles. Proprioception was normal. Deep tendon reflexes were normal except for absent ankle reflexes, and Romberg sign was absent. A nerve conduction study showed mild axonal neuropathy. At age 47 years, she developed slowly progressive resting hand tremor, slowing of her gait, bradykinesia, rigidity, and slurred speech. Results of magnetic resonance imaging of the brain were normal. She had a history of hypertension and gonadal dysgenesis. Findings from laboratory studies were normal, except for low serum free and total carnitine level. Present medications include amantadine, selegiline, levodopa, coenzyme Q, levocarnitine, and clonidine.

The patient’s 59-year-old brother (III-2) developed parkinsonism in his early 40s. Family history data revealed that the proband’s father (II-1), a paternal cousin (III-6), and the cousin’s daughter (IV-4) had PEO and exercise intolerance. Interestingly, several paternal relatives (II-1, III-4, III-5, IV-1, IV-3, and V-2) suffered from congenital cataract but had normal neurological examination results.

In a muscle biopsy from the proband, we performed a histochemical analysis of serial frozen sections and measured mitochondrial enzyme activities in muscle extracts by described methods.^{9 - 10}

Southern blot analysis on DNA extracted from the proband’s muscle was performed as described.¹¹ The entire coding regions of the POLG, ANT1, and Twinkle genes were amplified and sequenced as reported.⁵

Polymerase chain reaction and restriction fragment length polymorphism analyses were performed to confirm the mutation in DNA from the proband’s muscle and from the blood of several relatives (III-2, III-5, IV-1, IV-2, V-1, and V-2). We used the primers F-5′ mismatch ACCCCACCAGGCACCCCGACC and R-5′ GGGAGAGGAAGAGCAGGGGCC. Polymerase chain reaction conditions were 94°C for 3 minutes, followed by 35 cycles at 94°C for 1 minute, 64°C for 1 minute, 72°C for 1 minute, and a final extension step at 72°C for 7 minutes. The restriction enzyme BsiEI cuts only mutant DNA.

A histochemical examination of the proband’s muscle biopsy showed numerous ragged-red fibers with the modified Gomori trichrome stain and cytochrome-c oxidase–negative fibers with the cytochrome-c oxidase–succinate dehydrogenase stain.

Biochemical studies showed markedly increased citrate synthase activity, a good indicator of mitochondrial proliferation. When referred to citrate synthase, residual activities of respiratory chain complexes were as follows: complex I, 77%; complex III, 69%; and complex IV (cytochrome-c oxidase), 54%. In contrast, the activity of complex II was 121% of normal.

Southern blot analysis of DNA from the proband’s muscle showed multiple deletions of mtDNA. Screening of ANT1 and Twinkle genes did not show any mutation, whereas direct sequencing of the POLG gene revealed a heterozygous transition (A2492G) in exon 16, changing an encoded tyrosine to a cysteine at amino acid position 831 (Y831C) (Figure 2A).

Restriction fragment length polymorphism confirmed the presence of the heterozygous change in the 2 affected siblings (III-1 and III-2) but not in unaffected relatives (III-5, IV-1, IV-2, V-1, and V-2) or in 130 healthy controls.

We report a novel heterozygous missense change (A2492G) in the POLG gene in a family with autosomal dominant PEO, peripheral neuropathy, and—notably—parkinsonism. We consider this mutation pathogenic for several reasons. First, it is consistent with the clinical manifestation of PEO and peripheral neuropathy. Second, the mutated amino acid (Tyr831) is very close to motif A in the polymerase region of POLG encoding the α subunit, and most reported pathogenic mutations in POLG affect either the exonuclease or the polymerase domain.^{2 - 8} Third, this mutation was not found in 130 controls.

Although parkinsonism was not among the clinical features of the first reported patients with POLG mutations, it may be an important, albeit inconsistent, manifestation of these genetic defects because it was a prominent feature in 5 other families (Anu Suomalainen, MD, oral and written communication, 2004). The hypothesis of a mitochondrial role in the pathogenesis of idiopathic Parkinson disease was introduced by the report of parkinsonism induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, an inhibitor of complex I,¹² and was bolstered by findings that complex I activity was decreased in the substantia nigra of patients with Parkinson disease.¹³ Although the role of mitochondrial dysfunction and mtDNA mutations in the pathogenesis of Parkinson disease remains controversial, parkinsonism has been associated with several mtDNA mutations, including large-scale rearrangements^{14 - 17} and point mutations or microdeletions.^{18 - 19} On the contrary, specific mitochondrial polymorphisms seem to reduce the risk of Parkinson disease.²⁰

Congenital cataract is not a typical sign of POLG mutation: its occurrence in several members of this family, who had no neurological problems and no mutation in POLG, may be coincidental because there are several forms of congenital cataracts due to different genetic defects.²¹

Our findings confirm that the clinical manifestations of POLG mutations are more heterogeneous than those due to mutations in ANT1 or C10orf2. Parkinsonism should be added to PEO, psychiatric disorders, dysphagia, neuropathy, hypogonadism, and ataxia as another feature of POLG mutations. Conversely, POLG mutations should be considered in the differential diagnosis of parkinsonism, especially in families with autosomal dominant transmission.

Correspondence: Salvatore DiMauro, MD, 4-420 College of Physicians and Surgeons, 630 West 168th St, New York, NY (sd12@columbia.edu).

Accepted for Publication: February 19, 2004.

Author Contributions:Study concept and design: Mancuso, Filosto, Oh, and DiMauro. Acquisition of data: Filosto and DiMauro. Analysis and interpretation of data: Mancusoand DiMauro. Drafting of the manuscript: Mancuso, Filosto, and DiMauro. Critical revision of the manuscript for important intellectual content: Oh. Obtained funding: DiMauro.Administrative, technical, and material support: Filosto. Study supervision: Mancuso and DiMauro.

Funding/Support: This study was supported by grants NS11766 and PO1HD 32062 from the National Institutes of Health, Bethesda, Md, and by a grant from the Muscular Dystrophy Association, Tucson, Ariz. Dr Mancuso is supported by the Department of Neurosciences, University of Pisa, Pisa, Italy. Dr Filosto is supported by the Department of Neurological Sciences and Vision, University of Verona, Verona, Italy.