0
We're unable to sign you in at this time. Please try again in a few minutes.
Retry
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
Retry
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Original Contribution |

Inflammatory Cytokine Gene Polymorphisms and Increased Risk of Parkinson Disease FREE

Angelika D. Wahner, PhD; Janet S. Sinsheimer, PhD; Jeff. M. Bronstein, MD, PhD; Beate Ritz, MD, PhD
[+] Author Affiliations

Author Affiliations: Department of Epidemiology, UCLA School of Public Health (Drs Wahner and Ritz), and Departments of Biomathematics and Human Genetics (Dr Sinsheimer) and Neurology (Dr Bronstein), David Geffen School of Medicine at UCLA, University of California, Los Angeles, and Greater Los Angeles Veterans Administration Medical Center (Dr Bronstein), Los Angeles.


Arch Neurol. 2007;64(6):836-840. doi:10.1001/archneur.64.6.836.
Text Size: A A A
Published online

Background  The proinflammatory cytokines tumor necrosis factor α (TNF-α) and IL-1β (interleukin 1β) have a role in neuroinflammation, and functional polymorphisms in the TNF-α and IL-1β genes may affect susceptibility to Parkinson disease (PD).

Objective  To investigate whether functional DNA polymorphisms of the TNF-α and IL-1β genes affect the risk of PD.

Design  Population-based case-control study.

Setting  Three rural California counties (Fresno, Tulare, and Kern).

Participants  Two hundred eighty-nine incident idiopathic PD cases and 269 population control subjects, marginally matched by age, sex, and race/ethnicity.

Main Outcome Measures  Genotypes of IL-1β-511 and TNF-α-308.

Results  We observed a greater than 2-fold increased risk of PD among carriers of the homozygous variant genotype of IL-1β-511 (odds ratio [OR], 2.26; 95% confidence interval [CI], 1.27-4.02) and the homozygous variant genotype of TNF-α-308 (OR, 2.49; 95% CI, 0.90-6.85) and an almost 3-fold increased risk among carriers of the homozygous variant genotype for either or both polymorphisms (OR, 2.92; 95% CI, 1.66-5.16).

Conclusions  A smaller magnitude of PD risk increase among carriers of the heterozygous genotype for either or both polymorphisms suggests a gene-dosing effect (OR, 1.45; 95% CI, 0.97-2.16; P<.001 for trend). Results were not sensitive to exclusion of all nonwhite subjects or to adjustment for nonsteroidal anti-inflammatory drug use or smoking.

The underlying chronic inflammatory state evident in Parkinson disease (PD) suggests a role for neuroinflammation in dopaminergic cell death.1,2 A hallmark that is characteristic of chronic inflammation, the activation of microglia, is observed in patients with idiopathic PD and in patients who developed PD after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine self-administration.3,4 While the mechanism of microglia-mediated inflammation is not well understood, there is agreement that microglia contributions may at least amplify if not initiate injury to dopaminergic neurons.2 Activated microglia release inflammatory cytokines, including IL-1β (interleukin 1β) and tumor necrosis factor α (TNF-α), which may be among the factors involved in causing these detrimental effects. Several studies510 report a marked increase of cytokine levels in the brain and cerebrospinal fluid of patients with PD and a higher density of glial cells that express TNF-α, IL-1β, and other inflammatory cytokines in the substantia nigra of patients with PD compared with age-matched controls.

In this study, we focus on single nucleotide polymorphisms of the IL-1β and TNF-α genes, which encode proinflammatory cytokines. These polymorphisms were selected under the candidate gene approach, whereby we considered the gene polymorphism's functional relevance, allelic frequency, and implication in previous PD epidemiological studies. Inflammatory gene polymorphisms that were functionally relevant but that did not have a high enough allelic frequency (>5%) or were not implicated in the previous epidemiological literature were not studied. For both selected gene polymorphisms, the variant allele is reported to increase gene expression.11,12 To date, it remains uncertain whether either of these polymorphisms is a risk factor for PD because a few previous studies report equivocal results.1216 It also remains uncertain whether one polymorphism exerts its effect independent of the other or whether their effect on PD risk is modified by environmental exposures such as smoking or nonsteroidal anti-inflammatory drug (NSAID) use. To the best of our knowledge, we present results for the first population-based case-control study of either polymorphism in a non-Asian population; our study is also the first to assess the effect of both polymorphisms combined and in conjunction with environmental exposures on PD risk. We tried to limit misclassification of disease by using a movement disorder specialist (J.M.B.) to assess and confirm all clinical diagnoses of PD in our sample.

SUBJECTS

A population-based approach was used to recruit 289 patients with incident idiopathic PD enrolled within 3 years of first diagnosis and 269 control subjects from 3 rural California counties (Fresno, Tulare, and Kern) between January 1, 2001, and April 1, 2006. Population control subjects were randomly selected from Medicare records or from residential parcels sampled from a shape file of the tricounty area. Controls were marginally matched to cases by age, sex, and race/ethnicity.

A University of California, Los Angeles (UCLA) movement disorder specialist (J.M.B.) confirmed a diagnosis of clinically probable or possible PD if patients met the following criteria: (1) manifestation of at least 2 of the characteristics of resting tremor, bradykinesia, or cogwheel rigidity, at least 1 of which is resting tremor or bradykinesia; (2) no suggestion of parkinsonian syndrome due to trauma, brain tumor, infection, cerebrovascular disease, or other known neurological disease and no past treatment with dopamine-blocking or dopamine-depleting agents; (3) no atypical features such as prominent oculomotor palsy, cerebellar signs, vocal cord paresis, severe orthostatic hypotension, pyramidal signs, amyotrophy, or limb apraxia; (4) asymmetric onset; and (5) if treatment with levodopa had been initiated, symptomatic improvement after treatment. Probable cases met criteria 1 through 5. Possible cases exhibited at least 1 characteristic from criterion 1 and fulfilled criteria described in 2 and 3. Although sometimes included under criterion 1, postural reflex impairment was excluded as a criterion because it usually occurs late in PD and may typically occur early in other parkinsonian disorders (ie, multiple system atrophy and vascular parkinsonism).17

All participants provided blood or buccal samples for genotyping. Interviewers blinded to the case-control status of interviewees collected demographic and risk factor data through telephone interviews. Our medical questionnaire included questions regarding lifetime aspirin and nonaspirin NSAID use. All participants provided informed consent, and the study was approved by the UCLA ethics committee.

LABORATORY SAMPLES

Blood and buccal samples were stored and processed at the UCLA Biologic Specimen Core Facility. We genotyped the IL-1β-511 promoter polymorphism (rs16944), which exhibits a C (allele 1) to a T (allele 2) substitution at position 511, and the TNF-α-308 promoter polymorphism (rs1800629), which results from a G (allele 1) to an A (allele 2) transition at nucleotide 308. The IL-1β polymorphism was detected by polymerase chain reaction using the primers F5′GAGCTTATCTCCAGGGTTGC3′ and R5′BIO-TGAGGGTGTGGGTCTCTACC3′, and the TNF-α variant was detected by polymerase chain reaction using the primers F5′BIO-CCTGCATCCTGTCTGGAAGT3′ and R5′CTTCTGGGCCACTGACTGAT3′. Both products were analyzed via pyrosequencing.

STATISTICAL ANALYSIS

All analyses were performed using SAS 8.0 software (SAS Institute Inc, Cary, NC). We assessed Hardy-Weinberg equilibrium using a χ2 test. We compared the genotype frequencies of cases and controls and examined gene-dosing effects by comparing carriers of homozygous variant and heterozygous genotypes with carriers of the homozygous wild-type genotype. Stratified analysis was used to assess associations in subgroups by sex, age at diagnosis (≤60 vs >60 years), ever having smoked regularly (≥1 year), pack-years of smoking (0, >0 to <19, or ≥19 pack-years), and regular aspirin and nonaspirin NSAID use (≥2 tablets/wk for ≥1 month). We used logistic regression analysis with indicator variables for each genotype to obtain odds ratios (ORs) adjusted for sex, race/ethnicity, age at diagnosis (continuous), and pack-years of smoking (0, >0 to <10, ≥10 to <40, or ≥40 pack-years) for genotypes at each locus. We repeated some analyses using a log-additive model that relies on counts of allele frequency and assumes that disease risk increases in a log-linear fashion with allele frequency.

We also grouped together (1) carriers of a homozygous variant genotype for either or both polymorphisms and (2) carriers of a heterozygous genotype but no homozygous variant genotype for either or both polymorphisms and compared PD risk in these groups with PD risk among carriers of a homozygous wild-type genotype for both polymorphisms. Because of the potential for population stratification in our mixed-ethnicity population, we repeated the analyses restricting the population to white participants only (235 cases and 220 controls).

The total population accrued was primarily white (81.4%) and included Hispanics (9.1%), Native Americans (4.7%), Asians (2.7%), and black subjects (2.1%). The median age of cases at diagnosis was 70.1 years. Table 1 gives demographic characteristics of the study population. We controlled for the variables in Table 1 in our model independent of whether cases and controls differed at the univariate level because these factors could be confounders in a more complex multivariate manner. We also controlled for age, sex, and race/ethnicity to account for frequency matching on these variables. Cases and controls were found to be in Hardy-Weinberg equilibrium for both studied polymorphisms (range, P =.13 to P =.86).

Table Graphic Jump LocationTable 1.  Demographic Characteristics of the Study Population

Table 2 gives results for the IL-1β-511 and TNF-α-308 gene polymorphisms for the study population. The homozygous variant (2/2 genotype) of the IL-1β-511 polymorphism was more frequent in cases than in controls (16.6% vs 9.3%, respectively). Compared with carriers of the homozygous wild-type genotype, carriers of the homozygous variant genotype exhibited a greater than 2-fold (OR, 2.26; 95% confidence interval [CI], 1.27-4.02) increased risk of PD. This strong positive association was not seen in participants who were heterozygous for the variant allele (OR, 1.19; 95% CI, 0.82-1.72). However, when using a log-additive (allele count) model, we noted an increased risk for homozygous variant and heterozygous IL-1β-511 carriers (OR, 1.96; 95% CI, 1.16-3.29 for homozygotes; and OR, 1.40; 95% CI, 1.08-1.81 for heterozygotes). Adjusting for the TNF-α-308 polymorphism did not change our effect estimates. Similar effects were noted when restricting analyses to white participants (OR, 2.12; 95% CI, 1.11-4.07 for homozygotes; and OR, 1.08; 95% CI, 0.73-1.61 for heterozygotes). Population prevalences among the white controls only were 45.7% for the homozygous wild-type genotype, 46.5% for the heterozygous genotype, and 7.8% for the homozygous variant genotype.

Table Graphic Jump LocationTable 2. IL-1β-511 and TNF-α-308 Genotype Frequencies and Adjusted Odds Ratios (ORs)*

The homozygous variant (2/2 genotype) of the TNF-α-308 polymorphism was also more frequent in cases than in controls (4.5% vs 2.2%, respectively) (Table 2). Accordingly, our data suggested an increased PD risk among carriers of the homozygous variant genotype (OR, 2.49; 95% CI, 0.90-6.85), with similar results when restricting our analyses to white subjects (OR, 2.72; 95% CI, 0.93-8.00). Any association between PD risk and the heterozygous genotype was at best weak and was consistent with no association (OR, 1.14; 95% CI, 0.76-1.72). The observed increase in PD risk was weaker among carriers of the homozygous variant genotype but was stronger among carriers of the heterozygous genotype in a log-additive (allele count) model (OR, 1.68; 95% CI, 0.87-3.25 for homozygotes; and OR, 1.30; 95% CI, 0.93-1.80 for heterozygotes). Adjusting for the IL-1β-511 polymorphism did not change our effect estimates. Population prevalences among the white controls were 73.0% for the homozygous wild-type genotype, 24.7% for the heterozygous genotype, and 2.3% for the homozygous variant genotype.

Using stratified analysis, we observed no effect measure modification for either polymorphism by age at diagnosis, ever having smoked regularly, pack-years of smoking, or aspirin and nonaspirin NSAID use. Table 3 gives the results when assessing IL-1β-511 and TNF-α-308 variant alleles together for the study population. We found that carriers of a homozygous variant genotype for either or both polymorphisms exhibited an almost 3-fold (OR, 2.92; 95% CI, 1.66-5.16) increase in PD risk compared with those carrying a homozygous wild-type genotype for both polymorphisms. Furthermore, carriers of a heterozygous genotype but no homozygous variant genotype for either or both polymorphisms exhibited a 1.45-fold (OR, 1.45; 95% CI, 0.97-2.16) greater PD risk than those carrying a homozygous wild-type genotype for both polymorphisms, suggesting a gene-dosing effect (P<.001 for trend). We observed similar results when restricting our analyses to white subjects only (OR, 2.85; 95% CI, 1.52-5.35 for homozygotes; and OR, 1.36; 95% CI, 0.88-2.08 for heterozygotes; P =.001 for trend). Again, we observed no difference in effect estimates when stratifying by sex, age at diagnosis, ever having smoked regularly, pack-years of smoking, or aspirin and nonaspirin NSAID use. Results were not sensitive to controlling for aspirin and nonaspirin NSAID use or pack-years of smoking in our regression models.

Table Graphic Jump LocationTable 3. IL-1β-511 and TNF-α-308 Grouping Genotype Frequencies and Adjusted Odds Ratios (OR)*

The proteins encoded by the IL-1β and TNF-α genes are proinflammatory cytokines that actively regulate a broad spectrum of biological processes, most notably neuroinflammation.1820 The polymorphisms IL-1β-511 and TNF-α-308 are located in the promoter regions of their respective genes, and each is reported to result in increased gene expression levels.11,12

The greater than 2-fold increased risk of PD observed in carriers of the IL-1β-511 homozygous variant genotype is consistent with the notion that the variant 2 allele increases gene expression, as overexpression of IL-1β is hypothesized to lead to nigral degeneration by increasing susceptibility of dopaminergic neuronal cells to toxins.12,13 Findings from 2 studies12,13 among 3 previous studies1214 conducted among white populations suggested an increased risk of PD in carriers of the variant allele, in accord with our results. However, the estimated effect size among carriers of the homozygous variant genotype varied widely. McGeer et al13 reported a 9-fold (OR, 9.78; 95% CI, 2.70-35.45) increased risk, while Schulte et al12 suggested only a moderate increase in risk (OR, 1.45; 95% CI, 0.87-2.42 for homozygotes; and OR, 1.55; 95% CI, 1.08-2.22 for heterozygotes).12,13 Neither study used a population-based design. In addition, the study by McGeer et al13 drew from a small sample, as did the Finnish study14 reporting a decreased PD risk.

Tumor necrosis factor α has been shown to induce pathological changes in neuronal cells and is up-regulated in PD.6,21 Furthermore, TNF-α immunoreactive glial cells have been identified in the substantia nigra of patients with PD.9 Accordingly, our finding of an increased risk among carriers of the homozygous variant of the TNF-α-308 genotype is consistent with reports indicating that the variant allele of the TNF-α-308 polymorphism is a stronger transcriptional activator than the more common variant 1 allele.11 Two previous studies15,16 evaluating the relationship between TNF-α-308 and PD did not report risk increases. A small study by Ross et al15 observed no allele or genotype association between TNF-α-308 and PD but was likely statistically underpowered because of the rarity of the homozygous variant genotype. Krüger et al16 observed an increased risk only in carriers of the heterozygous genotype (OR, 1.53; 95% CI, 0.98-2.37), but it is unclear whether the control genotype frequency is representative of white populations because the patients with PD were a highly selected sample drawn from a tertiary care center.

Given that IL-1β and TNF-α are both involved in neuroinflammation and evidence exists that they may biologically interact, we also assessed the statistical independence of each gene polymorphism's association with PD risk. Indeed, IL-1 has biologically been shown to induce the expression of TNF-α.22 Although IL-1 and TNF-α act on distinct cell surface receptors, they share common signaling mechanisms, some of which have been identified in the central nervous system and relate to neurodegeneration.22 Both TNF-α and IL-1 reportedly activate the transcription factor nuclear factor κB in brain cells, particularly in glia, thereby implicating both genes in oxidative stress–induced apoptosis, which might be a possible mechanism for rendering neurons susceptible to inflammatory cytokines.23

If each gene polymorphism's association with PD was statistically independent, in logistic regression models we would expect to see a log-additive increase in PD risk in carriers of both homozygous variant genotypes. Unfortunately, we were unable to separately assess carriers of both homozygous variant genotypes because we identified no more than 2 such individuals. However, among carriers of at least 1 homozygous variant genotype, we noted an almost 3-fold increased risk of PD (Table 3) (ie, the point estimates were only slightly larger than those for homozygous carriers of each polymorphism alone). Given our results, one could speculate that IL-1β and TNF-α promoter variants act in the same biological pathway and trigger similar biological responses, such that high gene expression due to one or the other polymorphism achieves the same goal, while adding a second homozygous variant polymorphism will not increase PD risk further. Examining both genes together represents a relevant inquiry because 68% of our control population carried at least 1 variant allele of either or both polymorphisms, indicating that most individuals in a population carry variant polymorphisms that may increase PD risk and susceptibility.

We observed no effect measure modification by smoking or NSAID use, despite biological evidence linking inflammation to smoking and NSAID use, with smoking triggering acute inflammatory responses and NSAID use preventing cyclooxygenase-2 up-regulation (ie, the opposite effect of TNF-α and IL-1β inducing cyclooxygenase-2 expression).24,25 However, these subgroup analyses were limited by small sample sizes. It is also possible that, although carrying the variant genotype of the polymorphisms makes the carrier increasingly vulnerable to external insults that trigger neuroinflammation, smoking or NSAID use might not have occurred concomitantly with the relevant insult. Controlling for both factors did not affect our results for these polymorphisms.

Our study contributes to a growing body of evidence suggesting that proinflammatory cytokines exert their effect through complex and interacting biological pathways rather than independently and, more generally, that neuroinflammation has an important role in idiopathic PD. Further population-based studies are warranted to corroborate these novel findings. An understanding of proinflammatory cytokine biology will allow for better-informed epidemiological studies in which subjects can be grouped into relevant biological inflammatory response categories. An improved understanding of the relationship between neuroinflammation and PD might help identify patients at high risk for this neurodegenerative disorder and offer insight into preventative intervention.

Correspondence: Angelika D. Wahner, PhD, Department of Epidemiology, UCLA School of Public Health, University of California, Los Angeles, Campus Box 951772, 650 Charles E. Young Dr, Los Angeles, CA 90095-1772 (awahner@ucla.edu).

Accepted for Publication: November 13, 2006.

Author Contributions:Study concept and design: Wahner and Ritz. Acquisition of data: Wahner, Bronstein, and Ritz. Analysis and interpretation of data: Wahner, Sinsheimer, and Ritz. Drafting of the manuscript: Wahner, Sinsheimer, and Ritz. Critical revision of the manuscript for important intellectual content: Wahner, Sinsheimer, Bronstein, and Ritz. Statistical analysis: Wahner and Sinsheimer. Obtained funding: Ritz. Administrative, technical, and material support: Bronstein. Study supervision: Sinsheimer and Ritz.

Financial Disclosure: None reported.

Funding/Support: This study was supported by grants ES10544 and U54ES12078 from the National Institutes of Health–National Institute of Environmental Health Sciences and by pilot funding received from the Southern California Environmental Health Sciences Center 5P30 ES07048 and the American Parkinson Disease Association.

Sarkar  DFisher  PB Molecular mechanisms of aging-associated inflammation. Cancer Lett 2006;23613- 23
PubMed Link to Article
Hartmann  AHunot  SHirsch  E Inflammation and dopaminergic neuronal loss in Parkinson's disease: a complex matter. Exp Neurol 2003;184561- 564
PubMed Link to Article
McGeer  PLItagaki  SBoyes  BE Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology 1988;381285- 1291
PubMed Link to Article
Langston  JWForno  LSTetrud  JReeves  AGKaplan  JAKarluk  D Evidence of active nerve cell degeneration in the substantia nigra of humans years after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine exposure. Ann Neurol 1999;46598- 605
PubMed Link to Article
Nagatsu  TMogi  MIchinose  HTogari  A Changes in cytokines and neurotrophins in Parkinson's disease. J Neural Transm Suppl 2000;60277- 290
PubMed
Mogi  MHarada  MKondo  T  et al.  Interleukin-1β, interleukin-6, epidermal growth factor and transforming growth factor-α are elevated in the brain from parkinsonian patients. Neurosci Lett 1994;180147- 150
PubMed Link to Article
Blum-Degen  DMuller  TKuhn  WGerlach  MPrzuntek  HRiederer  P Interleukin-1β and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer's and de novo Parkinson's disease patients. Neurosci Lett 1995;20217- 20
PubMed Link to Article
Mogi  MHarada  MRiederer  PNarabayashi  HFujita  KNagatsu  T Tumor necrosis factor-α (TNF-α) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients. Neurosci Lett 1994;165208- 210
PubMed Link to Article
Boka  GAnglade  PWallach  DJavoy-Agid  FAgid  YHirsch  EC Immunocytochemical analysis of tumor necrosis factor and its receptors in Parkinson's disease. Neurosci Lett 1994;172151- 154
PubMed Link to Article
Hunot  SDugas  NFaucheux  B  et al.  FcεRII/CD23 is expressed in Parkinson's disease and induces, in vitro, production of nitric oxide and tumor necrosis factor-α in glial cells. J Neurosci 1999;193440- 3447
PubMed
Wilson  AGSymons  JAMcDowell  TLMcDevitt  HODuff  GW Effects of a polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci U S A 1997;943195- 3199
PubMed Link to Article
Schulte  TSchols  LMuller  TWoitalla  DBerger  KKrüger  R Polymorphisms in the interleukin-1 α and β genes and the risk for Parkinson's disease. Neurosci Lett 2002;32670- 72
PubMed Link to Article
McGeer  PLYasojima  KMcGeer  EG Association of interleukin-1β polymorphisms with idiopathic Parkinson's disease. Neurosci Lett 2002;32667- 69
PubMed Link to Article
Mattila  KMRinne  JOLehtimaki  TRoytta  MAhonen  JPHurme  M Association of an interleukin 1β gene polymorphism (-511) with Parkinson's disease in Finnish patients [letter]. J Med Genet 2002;39400- 402
PubMed Link to Article
Ross  OAO’Neill  CRea  IM  et al.  Functional promoter region polymorphism of the proinflammatory chemokine IL-8 gene associates with Parkinson's disease in the Irish. Hum Immunol 2004;65340- 346
PubMed Link to Article
Krüger  RHardt  CTschentscher  F  et al.  Genetic analysis of immunomodulating factors in sporadic Parkinson's disease. J Neural Transm 2000;107553- 562
PubMed Link to Article
Hughes  AJBen-Shlomo  YDaniel  SELees  AJ What features improve the accuracy of clinical diagnosis in Parkinson's disease? a clinicopathologic study. Neurology 1992;421142- 1146
PubMed Link to Article
He  YAppel  SLe  W Minocycline inhibits microglial activation and protects nigral cells after 6-hydroxydopamine injection into mouse striatum. Brain Res 2001;909187- 193
PubMed Link to Article
Wu  DCJackson-Lewis  VVila  M  et al.  Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson disease. J Neurosci 2002;221763- 1771
PubMed
Sriram  KMatheson  JMBenkovic  SAMiller  DBLuster  MIO’Callaghan  JP Mice deficient in TNF receptors are protected against dopaminergic neurotoxicity: implications for Parkinson's disease. FASEB J 2002;161474- 1476
PubMed
Selmaj  KRaine  CS Tumor necrosis factor mediates myelin damage in organotypic cultures of nervous tissue. Ann N Y Acad Sci 1988;540568- 570
PubMed Link to Article
Allan  SMRothwell  NJ Cytokines and acute neurodegeneration. Nat Rev Neurosci 2001;2734- 744
PubMed Link to Article
Rothwell  NJLuheshi  GN Interleukin 1 in the brain: biology, pathology and therapeutic target. Trends Neurosci 2000;23618- 625
PubMed Link to Article
van der Vaart  HPostma  DSTimens  W  et al.  Acute effects of cigarette smoking on inflammation in healthy intermittent smokers. Respir Res 2005;622- 33
PubMed Link to Article
Teismann  PVila  MChoi  DK  et al.  COX-2 and neurodegeneration in Parkinson's disease. Ann N Y Acad Sci 2003;991272- 277
PubMed Link to Article

Figures

Tables

Table Graphic Jump LocationTable 1.  Demographic Characteristics of the Study Population
Table Graphic Jump LocationTable 2. IL-1β-511 and TNF-α-308 Genotype Frequencies and Adjusted Odds Ratios (ORs)*
Table Graphic Jump LocationTable 3. IL-1β-511 and TNF-α-308 Grouping Genotype Frequencies and Adjusted Odds Ratios (OR)*

References

Sarkar  DFisher  PB Molecular mechanisms of aging-associated inflammation. Cancer Lett 2006;23613- 23
PubMed Link to Article
Hartmann  AHunot  SHirsch  E Inflammation and dopaminergic neuronal loss in Parkinson's disease: a complex matter. Exp Neurol 2003;184561- 564
PubMed Link to Article
McGeer  PLItagaki  SBoyes  BE Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology 1988;381285- 1291
PubMed Link to Article
Langston  JWForno  LSTetrud  JReeves  AGKaplan  JAKarluk  D Evidence of active nerve cell degeneration in the substantia nigra of humans years after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine exposure. Ann Neurol 1999;46598- 605
PubMed Link to Article
Nagatsu  TMogi  MIchinose  HTogari  A Changes in cytokines and neurotrophins in Parkinson's disease. J Neural Transm Suppl 2000;60277- 290
PubMed
Mogi  MHarada  MKondo  T  et al.  Interleukin-1β, interleukin-6, epidermal growth factor and transforming growth factor-α are elevated in the brain from parkinsonian patients. Neurosci Lett 1994;180147- 150
PubMed Link to Article
Blum-Degen  DMuller  TKuhn  WGerlach  MPrzuntek  HRiederer  P Interleukin-1β and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer's and de novo Parkinson's disease patients. Neurosci Lett 1995;20217- 20
PubMed Link to Article
Mogi  MHarada  MRiederer  PNarabayashi  HFujita  KNagatsu  T Tumor necrosis factor-α (TNF-α) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients. Neurosci Lett 1994;165208- 210
PubMed Link to Article
Boka  GAnglade  PWallach  DJavoy-Agid  FAgid  YHirsch  EC Immunocytochemical analysis of tumor necrosis factor and its receptors in Parkinson's disease. Neurosci Lett 1994;172151- 154
PubMed Link to Article
Hunot  SDugas  NFaucheux  B  et al.  FcεRII/CD23 is expressed in Parkinson's disease and induces, in vitro, production of nitric oxide and tumor necrosis factor-α in glial cells. J Neurosci 1999;193440- 3447
PubMed
Wilson  AGSymons  JAMcDowell  TLMcDevitt  HODuff  GW Effects of a polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci U S A 1997;943195- 3199
PubMed Link to Article
Schulte  TSchols  LMuller  TWoitalla  DBerger  KKrüger  R Polymorphisms in the interleukin-1 α and β genes and the risk for Parkinson's disease. Neurosci Lett 2002;32670- 72
PubMed Link to Article
McGeer  PLYasojima  KMcGeer  EG Association of interleukin-1β polymorphisms with idiopathic Parkinson's disease. Neurosci Lett 2002;32667- 69
PubMed Link to Article
Mattila  KMRinne  JOLehtimaki  TRoytta  MAhonen  JPHurme  M Association of an interleukin 1β gene polymorphism (-511) with Parkinson's disease in Finnish patients [letter]. J Med Genet 2002;39400- 402
PubMed Link to Article
Ross  OAO’Neill  CRea  IM  et al.  Functional promoter region polymorphism of the proinflammatory chemokine IL-8 gene associates with Parkinson's disease in the Irish. Hum Immunol 2004;65340- 346
PubMed Link to Article
Krüger  RHardt  CTschentscher  F  et al.  Genetic analysis of immunomodulating factors in sporadic Parkinson's disease. J Neural Transm 2000;107553- 562
PubMed Link to Article
Hughes  AJBen-Shlomo  YDaniel  SELees  AJ What features improve the accuracy of clinical diagnosis in Parkinson's disease? a clinicopathologic study. Neurology 1992;421142- 1146
PubMed Link to Article
He  YAppel  SLe  W Minocycline inhibits microglial activation and protects nigral cells after 6-hydroxydopamine injection into mouse striatum. Brain Res 2001;909187- 193
PubMed Link to Article
Wu  DCJackson-Lewis  VVila  M  et al.  Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson disease. J Neurosci 2002;221763- 1771
PubMed
Sriram  KMatheson  JMBenkovic  SAMiller  DBLuster  MIO’Callaghan  JP Mice deficient in TNF receptors are protected against dopaminergic neurotoxicity: implications for Parkinson's disease. FASEB J 2002;161474- 1476
PubMed
Selmaj  KRaine  CS Tumor necrosis factor mediates myelin damage in organotypic cultures of nervous tissue. Ann N Y Acad Sci 1988;540568- 570
PubMed Link to Article
Allan  SMRothwell  NJ Cytokines and acute neurodegeneration. Nat Rev Neurosci 2001;2734- 744
PubMed Link to Article
Rothwell  NJLuheshi  GN Interleukin 1 in the brain: biology, pathology and therapeutic target. Trends Neurosci 2000;23618- 625
PubMed Link to Article
van der Vaart  HPostma  DSTimens  W  et al.  Acute effects of cigarette smoking on inflammation in healthy intermittent smokers. Respir Res 2005;622- 33
PubMed Link to Article
Teismann  PVila  MChoi  DK  et al.  COX-2 and neurodegeneration in Parkinson's disease. Ann N Y Acad Sci 2003;991272- 277
PubMed Link to Article

Correspondence

CME
Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
Submit a Comment

Multimedia

Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 57

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Collections
PubMed Articles