0
Original Contribution |

Presence of Alanine-to-Valine Substitutions in Myofibrillogenesis Regulator 1 in Paroxysmal Nonkinesigenic Dyskinesia:  Confirmation in 2 Kindreds FREE

Dong-Hui Chen, MD, PhD; Mark Matsushita, BS; Shirley Rainier, PhD; Brandon Meaney, MD; Lisa Tisch, BS; Abreham Feleke, BS; John Wolff, BS; Hillary Lipe, ARNP; John Fink, MD; Thomas D. Bird, MD; Wendy H. Raskind, MD, PhD
Arch Neurol. 2005;62(4):597-600. doi:10.1001/archneur.62.4.597.
Text Size: A A A
Published online

Background  Paroxysmal nonkinesigenic dyskinesia (PNKD) is a rare disorder characterized by attacks of involuntary movements brought on by stress, alcohol, or caffeine, but not by movement. An autosomal dominant form of this disorder was mapped to chromosome 2q33-36, and different missense mutations in exon 1 of the myofibrillogenesis regulator 1 (MR1) gene were identified recently in 2 kindreds.

Objectives  To describe studies on a new pedigree with PNKD, to explore the possibility of locus heterogeneity, and to further delineate the spectrum of mutations in MR1 in 2 families with PNKD.

Design, Setting, and Patients  All 10 exons of MR1 were sequenced in DNA from members of 2 pedigrees with autosomal dominant PNKD.

Results  Different missense mutations in exon 1 of MR1 that cosegregate with disease were identified in each multiplex family. These single-nucleotide mutations predicted substitution of valine for alanine in residue 7 in one family and residue 9 in the other. The same mutations were found in the only 2 families previously published. Family history and haplotype analysis make it unlikely that the families with the same mutations are related.

Conclusions  The function of MR1 is unknown, but the 2 mutations identified in the 4 families with PNKD studied to date are predicted to disrupt the amino terminal α-helix suggesting that this region of the gene is critical for proper gene function under stressful conditions. Study of additional families will be important to determine whether analysis of a single exon (MR1 exon 1) is sufficient for genetic testing purposes.

Figures in this Article

Paroxysmal nonkinesigenic dyskinesia (PNKD; Mendelian Inheritance in Man 11880), also called paroxysmal dystonic choreoathetosis, is a fascinating disorder in which affected individuals experience attacks of involuntary choreiform and/or dystonic movements.1 This disorder may involve the face as well as the extremities. The attacks often begin in childhood; can be precipitated by ovulation, menstruation, emotional stress, fatigue, caffeine, or alcohol; and may last minutes to hours. Paroxysmal nonkinesigenic dyskinesia is distinct from a related disorder, paroxysmal kinesigenic choreoathetosis (PKC), in which brief and frequent dyskinetic attacks are provoked by sudden movement.1 Large families with PNKD appropriate for mapping analyses are rare, and linkage studies have been reported on only 6 families, including 1 family (ED01) studied by our group.27 These linkage studies defined a single PNKD locus on chromosome 2q33-36. Recently, missense mutations in exon 1 of the myofibrillogenesis regulator 1 (MR1) gene were identified in 2 families with PNKD.8 The present study was undertaken to describe a new, large pedigree with PNKD (ED03), to explore the possibility of locus heterogeneity, and to further delineate the spectrum of mutations in MR1.

SUBJECTS

Under protocols approved by the institutional review board of the University of Washington, Seattle, blood samples from 16 members of family ED01 and 8 members of family ED03 were collected and genomic DNA was isolated from leukocytes as previously described.9 A sample was also collected from an apparently isolated case of PKC (ED04).

LINKAGE ANALYSIS

Genotyping of polymorphic markers D2S128, D2S2359, D2S126, and D2S130, D2S344, D2S163, D2S377, and D2S2148 (Research Genetics, Huntsville, Ala), which flank the PNKD critical region, were performed in family ED03 with radiolabeling as previously described.6 Power and 2-point linkage analyses were performed with the SLINK and the MLINK subprograms of the LINKAGE software package, version 5.1.1011 Multipoint analyses were performed with GENEHUNTER, version 1.2,12 and VITESSE.13 (Linkage analysis of family ED01 has been described by Raskind et al.6) The statistical analyses for ED03 were performed under the assumptions of autosomal dominant inheritance, a disease frequency of 0.0001, and 90% penetrance.

MUTATIONAL AND HAPLOTYPING ANALYSES

To analyze MR1, fragments encompassing each of the 10 coding exons and corresponding splice junctions were amplified using the following forward and reverse primer pairs, all given in 5′ to 3′ direction: exon 1, TGTAGGCAGGACGGAAGGAG and TGCAGAAAAGTGTGGGGAGGAACC; exon 2, CTCCTCCCAAGCCCTTACT and AGCTCGCCACCTGAAAC; exon 3, AGGGGAGCTAGGGAGAAAAG and GTGGGCGGGGTAACAGG; exon 4, CCGCCTGCTCCCCTTCACATAC and CCGCCTGCTCCCCTTCACATAC; exon 5, TCCATCCCTTTCCTCTGCTTCATC and CTCTCCTCCCTCCCTGCTGGTGT; exon 6, CTTGAGTTGTTGGGGGCGATGTT and AGGAAGGGCACTGGCAAAGAT; exon 7, GGCACAGATCCAATACCT and CAACATCTGTGCTAAAACTAAG; exon 8, ATGCCTGGGGTGGGTCTGGAAAGT and GTGGGGCTGGAGGATGGGGAGTAG; exon 9, CTAGTTGTCAGGTGCCCATCA and ACCCGACCCCTGCCCCATCCT; and exon 10, GGGGCAGGGGTCGGGTCAGG and GGTGCCGATGGAGGTGGTGGTGTT. Exon fragments were amplified with FastStart Taq polymerase (Roche Diagnostics Corporation, Indianapolis, Ind), in a total volume of 20 μL containing polymerase chain reaction (PCR) buffer provided with the enzyme, 0.5M 2-(trimethylammonio) ethanoic acid (Betaine; Sigma-Aldrich Corp, St Louis, Mo), 0.5 μmol/L of each primer, 800 μmol/L of deoxynucleotide triphosphate mixture, and 60 ng of DNA. The PCR amplification profile contains an initial denaturation step at 95°C for 5 minutes, 33 cycles at 95°C for 45 seconds, 64°C (or 54°C for the exon 7 fragment) for 45 seconds, and 72°C for 1 minute, with a final extension at 72°C for 10 minutes. By methods previously described,14 direct DNA sequencing was performed using the forward primers, and electrophoresis was carried out on a genetic analyzer (ABI PRISM 3100 Avant Genetic Analyzer; Applied Biosystems, Foster City, Calif). To confirm the sequence alterations, exon 1 was also sequenced in reverse.

The nucleotide substitutions 66C→T and 72C→T eliminated restriction endonuclease recognition sites for TseI and HaeII, respectively. Restriction fragment length polymorphism (RFLP) analyses with these enzymes (New England Biolabs, Beverly, Mass) were performed in affected individuals and control subjects on 271–base pair (bp) exon 1 PCR fragments, under conditions suggested by the manufacturer. Restriction fragments were separated on 3% agarose gels. TseI digestion of the wild-type allele generated fragments of 165 bp and 106 bp, and HaeII digestion of the wild-type allele generated fragments of 153 bp and 118 bp. The mutant allele is not digested by either of these enzymes.

To address the possibility that the families bearing the same MR1 mutations are genetically related, genotypes for fluorescent markers D2S325, D2S2382, D2S1338, D2S433, D2S126, and D2S396, which flank the gene, were analyzed as previously described.15 In addition, haplotypes were constructed manually for members of families ED01 and ED03 and for 2 affected members of families PDC-Det and PDC-PA, who were previously described by Rainier et al.8

PEDIGREES

A description of family ED01 (Figure 1A), of German background, was previously published.6 The pedigree of a newly ascertained family of predominantly French and Irish background, ED03, is shown in Figure 1B. The neurologic disorder could be traced back 4 generations to French Canadian family members living in New Brunswick. In family ED03, PNKD is characterized by sustained dystonic postures of arms, trunk, or neck that last many minutes to more than an hour. In some family members, symptoms of PNKD were first manifested in infancy. Although more subtle initially, the parents noticed the symptoms because they were looking for them (knowing that it was a “family curse” from previous generations). In childhood, overexcitement or being overtired could precipitate an attack. In adulthood, attacks could be provoked by stress/anxiety, fatigue/insufficient sleep, caffeine, or alcohol. In the affected adults, the frequency and severity of attacks have not worsened over the life span, and in at least 1 person they have diminished by middle age (at approximately 50 years of age). None of the affected members have developed additional neurologic symptoms or signs. Some affected adults in this family have found that relaxation techniques lessen the intensity of the symptoms and sometimes stop an attack. Carbamazepine was of no benefit, but benzodiazepines have been somewhat helpful. The phenotype of individual ED04 differs from that of families ED01 and ED03 in that the episodes are shorter (seconds to minutes) and precipitated by movement but not caffeine. The disorder in individual ED04 is therefore consistent with PKC rather than PNKD.

Place holder to copy figure label and caption
Figure 1.

Pedigrees of 2 families segregating autosomal dominant paroxysmal nonkinesigenic dyskinesia (PNKD). Squares denote males; circles, females; diamonds, individuals whose sex is not revealed; and diagonal slashes, deceased. Individuals affected by PNKD are denoted by black symbols. A black circle within the icon denotes an obligate heterozygote; stars, that samples were obtained; and numbers in icons, that more than 1 individual is represented. For privacy considerations, the order within sibships has been altered and ages are not indicated.

Grahic Jump Location
POWER AND LINKAGE ANALYSES

Our group previously confirmed linkage of PNKD to chromosome 2q in a 3-generation family, ED01 (Figure 1A), for which a maximum pairwise logarithm of odds (LOD) score of 4.19 at θ = 0.001 was obtained for the marker D2S120.6 Samples were available from 8 members of family ED03. Power analysis using all 8 subjects and 8 markers spanning the critical region suggested that these samples could yield average and maximum 2-point LOD scores of 0.819 and 1.28, respectively, at θ = 0. A maximum multipoint LOD score of 1.46 at θ = 0.08 was obtained with both GENEHUNTER12 and VITESSE.13 Although not sufficient to confirm linkage, these data are consistent with linkage of disease in family ED03 to the chromosome 2q PNKD locus.

IDENTIFICATION OF MR1 MUTATIONS IN FAMILIES WITH PNKD

The 10 exons and splice junctions of MR1 were amplified with the use of PCR and sequenced in members of families ED01 and ED03 and in individual ED04. No sequence alteration was detected in ED04, the subject with PKC. Heterozygous C-to-T transitions were identified in nucleotide 72 (affecting residue 9) and nucleotide 66 (affecting residue 7) in affected members of ED01 and ED03, respectively (Figure 2). These sequence changes both predict substitution of valine for alanine in the respective residues. No other sequence alterations were found. The mutation segregated with the disease in all 8 affected individuals tested and in an obligate carrier in family ED01. The 6 at-risk, unaffected members had the wild-type sequence. The spouse of the obligate carrier also had the wild-type sequence. In ED03, the mutation was also found in all affected individuals tested and in neither of the unaffected individuals. The RFLP analyses with TseI and HaeII in affected individuals confirmed the 66C→T and 72C→T mutations, respectively. Paroxysmal nonkinesigenic dyskinesia is a rare disorder, and these are the same nucleotide changes seen in the 2 families described by Rainier et al.8 To investigate the possibility that the families bearing the same mutation are genetically related, 3 markers proximal to the gene—D2S325 (204.53 centimorgans [cM]), D2S2382 (213.49 cM), and D2S1338 (215.78 cM; 219 082 kilobase pairs [kbp])—and 3 markers distal to it—D2S433 (216.31 cM; 219 968 kbp), D2S126 (221.13 cM), and D2S396 (232.9 cM)—underwent genotyping, and haplotypes were compared in the relevant pairs of families. The MR1 gene is at 219 337 to 2 194 140 kbp on the National Center for Biotechnology Information map, build 34.3. The 72C→T mutation was present in the PDC-Det kindred (of Polish ancestry) described by Rainier et al8 and in the ED01 kindred (of German ancestry) from the present study. The 66C→T mutation was present in the PDC-Pa kindred (of English and mixed European ancestry) described by Rainier et al8 and in the ED03 kindred (of French ancestry) in the present study. The disease-related haplotypes in families PDC-Det and ED01 were completely different, with the exception of D2S433, the distal marker closest to MR1. This marker has a relatively low polymorphic information content of 0.6, and in all 4 families the common 191-bp allele (57.6%) was shared by all 11 persons tested, including those who were unaffected as well as those who were affected. In families PDC-Pa and ED-03, the disease-related haplotypes proximal to MR1 were dissimilar, but they also shared the common 191 allele of D2S433, and a recombination event that occurred in family ED03 distal to this marker precluded comparison of the distal portion of the region in these 2 families. Haplotypes based on intragenic single nucleotide polymorphisms rather than flanking markers would be more convincing if they were informative in these families, but the observation of such distinct haplotypes in at least 1 of the 2 sets of families argues for independent mutation events.

Place holder to copy figure label and caption
Figure 2.

Reverse-strand chromatograms for portions of exon 1 of the myofibrillogenesis regulator 1 gene that show heterozygous mutations in affected individuals from 2 families with paroxysmal nonkinesigenic dyskinesia as compared with control subjects. The G→A changes shown correspond to C→T transitions in the coding strands in nucleotide 72 in family ED01 (A) and nucleotide 66 in family ED03 (B).

Grahic Jump Location

The detection of mutations in 2 additional families confirms that MR1 is responsible for PNKD. The MR1 gene encodes 2 isoforms (NM_015488 and NM_022572) that differ in the first 2 exons and that have different expression patterns.8 The mutations identified in PNKD are located in exon 1 of the brain-specific transcript NM_015488. The function of MR1 is unknown, but the observation that the 2 recurrent mutations identified to date disrupt the amino terminal α-helix suggests that this region of the gene is critical for proper gene function under certain stressful conditions. The haplotype analysis suggests that the A9V mutation occurred independently in 2 families, and this may also be true of the 2 A7V mutations. In the 4 families with identified MR1 mutations to date, there are now 2 instances of decreased penetrance, both in females (families PDC-Det and ED01).

The possibility that there may be a very limited spectrum of mutations that result in the phenotype of PNKD has implications for genetic testing approaches. The amino terminal portion of the MR1 protein is very rich in alanine: 10 of the first 30 residues are alanines. The Protein Sequence Analysis (PSA) Protein Structure Prediction Server16 predicts that 5 of these 10 alanines, all located among the first 10 amino acids of the protein, have at least a 60% probability of participating in an α-helix structure. Changing any of these 5 alanines to valine markedly reduces the probability. The 2 alanine-to-valine mutations identified to date in patients with PNKD are detectable by RFLP analysis. It will be important to study additional families to determine whether RFLP or sequence analysis of only a single exon in MR1 is sufficient in molecular screening for PNKD.

The gene for the kinesigenic form, PKC, has been mapped to chromosome 16p11.2-q12.1.1 Because few families with either PNKD or PKC have been studied, it is not known whether there is overlap in the phenotypes or whether these disorders are genetically completely distinct. It is not possible to determine a chromosomal location for the gene responsible for PKC in individual ED04 because this is an isolated case. However, the absence of an MR1 mutation in ED04 is consistent with separate causes and locus heterogeneity for these 2 clinically similar disorders.

Correspondence: Wendy H. Raskind, MD, PhD, Medical Genetics, Department of Medicine, Box 35-7720, University of Washington, Seattle, WA 98195-7720 (wendyrun@u.washington.edu).

Accepted for Publication: June 14, 2004.

Author Contributions:Study concept and design: Chen, Matsushita, Rainier, Fink, Bird, and Raskind. Acquisition of data: Chen, Matsushita, Meaney, Tisch, Feleke, Wolff, Lipe, Fink, Bird, and Raskind. Analysis and interpretation of data: Chen, Tisch, Fink, and Raskind. Drafting of the manuscript: Chen, Tisch, and Raskind. Critical revision of the manuscript for important intellectual content: Chen, Matsushita, Rainier, Meaney, Tisch, Feleke, Wolff, Lipe, Fink, Bird, and Raskind. Statistical analysis: Matsushita, Tisch, Fink, and Raskind. Obtained funding: Chen, Fink, and Bird. Administrative, technical, and material support: Rainier, Meaney, Wolff, Lipe, and Bird. Study supervision: Chen, Fink, and Raskind.

Funding/Support: This study was supported in part by funds from the Department of Veterans Affairs, Washington, DC (Mr Wolff, Ms Lipe, and Drs Fink, Bird, and Raskind); grants R01-NS33645, R01-NS36177, and R01-NS38713 from the National Institutes of Health, Bethesda, Md (Drs Rainier and Fink), the University of Washington Royalty Research Fund (Dr Chen), and the Mary Gates Endowment for Students, Seattle (Ms Tisch); and a grant from the National Aeronautics and Space Administration to the Washington Space Grant program, Seattle (Ms Tisch).

Acknowledgment: We thank the many members of the families who participated in this research.

Bhatia  KP Familial (idiopathic) paroxysmal dyskinesias: an update. Semin Neurol 2001;2169- 74
PubMed
Fouad  GTServidei  SDurcan  SBertini  EPtacek  LJ A gene for familial paroxysmal dyskinesia (FPD1) maps to chromosome 2q. Am J Hum Genet 1996;59135- 139
PubMed
Fink  JKRainier  SWilkowski  J  et al.  Paroxysmal dystonic choreoathetosis: tight linkage to chromosome 2q. Am J Hum Genet 1996;59140- 145
PubMed
Hofele  KBenecke  RAuburger  G Gene locus FPD1 of the dystonic Mount-Reback type of autosomal-dominant paroxysmal choreoathetosis. Neurology 1997;491252- 1257
PubMed
Jarman  PRDavis  MBHodgson  SVMarsden  CDWood  NW Paroxysmal dystonic choreoathetosis. Brain 1997;1202125- 2130
PubMed
Raskind  WHBolin  TWolff  J  et al.  Further localization of a gene for paroxysmal dystonic choreoathetosis to a 5-cM region on chromosome 2q34. Hum Genet 1998;10293- 97
PubMed
Matsuo  HKamakura  KSaito  M  et al.  Familial paroxysmal dystonic choreoathetosis. Arch Neurol 1999;56721- 726
PubMed
Rainier  SThomas  DTokarz  D  et al.  Myofibrillogenesis regulator 1 gene mutations cause paroxysmal dystonia choreoathetosis. Arch Neurol 2004;611025- 1029
PubMed
Raskind  WHConrad  EUChansky  HMatsushita  M Loss of heterozygosity in chondrosarcomas for markers linked to hereditary multiple exostoses loci on chromosomes 8 and 11. Am J Hum Genet 1995;561132- 1139
PubMed
Lathrop  GMLalouel  JMJulier  COtt  J Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;813443- 3446
PubMed
Schaffer  AAGupta  SKShriram  KCottingham  RW Avoiding recomputation in linkage analysis. Hum Hered 1994;44225- 237
PubMed
Kruglyak  LDaly  MJReeve-Daly  MPLander  ES Parametric and nonparametric linkage analysis. Am J Hum Genet 1996;581347- 1363
PubMed
O’Connell  JRWeeks  DE The VITESSE algorithm for rapid exact multilocus linkage analysis via genotype set-recoding and fuzzy inheritance. Nat Genet 1995;11402- 408
PubMed
Chen  D-HBrkanac  ZVerlinde  CLMJ  et al.  Missense mutations in the regulatory domain of PKCγ. Am J Hum Genet 2003;72839- 849
PubMed
Brkanac  ZFernandez  MMatsushita  M  et al.  Autosomal dominant sensory/motor neuropathy with ataxia (SMNA). Am J Med Genet 2002;114450- 457
PubMed
 Protein Structure Prediction Server PSA.  Available at: http://bmerc-www.bu.edu/psa/. Accessed May 10, 2004

Figures

Place holder to copy figure label and caption
Figure 1.

Pedigrees of 2 families segregating autosomal dominant paroxysmal nonkinesigenic dyskinesia (PNKD). Squares denote males; circles, females; diamonds, individuals whose sex is not revealed; and diagonal slashes, deceased. Individuals affected by PNKD are denoted by black symbols. A black circle within the icon denotes an obligate heterozygote; stars, that samples were obtained; and numbers in icons, that more than 1 individual is represented. For privacy considerations, the order within sibships has been altered and ages are not indicated.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 2.

Reverse-strand chromatograms for portions of exon 1 of the myofibrillogenesis regulator 1 gene that show heterozygous mutations in affected individuals from 2 families with paroxysmal nonkinesigenic dyskinesia as compared with control subjects. The G→A changes shown correspond to C→T transitions in the coding strands in nucleotide 72 in family ED01 (A) and nucleotide 66 in family ED03 (B).

Grahic Jump Location

Tables

Interactive Graphics

Video

Country-Specific Mortality and Growth Failure in Infancy and Yound Children and Association With Material Stature

Use interactive graphics and maps to view and sort country-specific infant and early dhildhood mortality and growth failure data and their association with maternal

References

Bhatia  KP Familial (idiopathic) paroxysmal dyskinesias: an update. Semin Neurol 2001;2169- 74
PubMed
Fouad  GTServidei  SDurcan  SBertini  EPtacek  LJ A gene for familial paroxysmal dyskinesia (FPD1) maps to chromosome 2q. Am J Hum Genet 1996;59135- 139
PubMed
Fink  JKRainier  SWilkowski  J  et al.  Paroxysmal dystonic choreoathetosis: tight linkage to chromosome 2q. Am J Hum Genet 1996;59140- 145
PubMed
Hofele  KBenecke  RAuburger  G Gene locus FPD1 of the dystonic Mount-Reback type of autosomal-dominant paroxysmal choreoathetosis. Neurology 1997;491252- 1257
PubMed
Jarman  PRDavis  MBHodgson  SVMarsden  CDWood  NW Paroxysmal dystonic choreoathetosis. Brain 1997;1202125- 2130
PubMed
Raskind  WHBolin  TWolff  J  et al.  Further localization of a gene for paroxysmal dystonic choreoathetosis to a 5-cM region on chromosome 2q34. Hum Genet 1998;10293- 97
PubMed
Matsuo  HKamakura  KSaito  M  et al.  Familial paroxysmal dystonic choreoathetosis. Arch Neurol 1999;56721- 726
PubMed
Rainier  SThomas  DTokarz  D  et al.  Myofibrillogenesis regulator 1 gene mutations cause paroxysmal dystonia choreoathetosis. Arch Neurol 2004;611025- 1029
PubMed
Raskind  WHConrad  EUChansky  HMatsushita  M Loss of heterozygosity in chondrosarcomas for markers linked to hereditary multiple exostoses loci on chromosomes 8 and 11. Am J Hum Genet 1995;561132- 1139
PubMed
Lathrop  GMLalouel  JMJulier  COtt  J Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;813443- 3446
PubMed
Schaffer  AAGupta  SKShriram  KCottingham  RW Avoiding recomputation in linkage analysis. Hum Hered 1994;44225- 237
PubMed
Kruglyak  LDaly  MJReeve-Daly  MPLander  ES Parametric and nonparametric linkage analysis. Am J Hum Genet 1996;581347- 1363
PubMed
O’Connell  JRWeeks  DE The VITESSE algorithm for rapid exact multilocus linkage analysis via genotype set-recoding and fuzzy inheritance. Nat Genet 1995;11402- 408
PubMed
Chen  D-HBrkanac  ZVerlinde  CLMJ  et al.  Missense mutations in the regulatory domain of PKCγ. Am J Hum Genet 2003;72839- 849
PubMed
Brkanac  ZFernandez  MMatsushita  M  et al.  Autosomal dominant sensory/motor neuropathy with ataxia (SMNA). Am J Med Genet 2002;114450- 457
PubMed
 Protein Structure Prediction Server PSA.  Available at: http://bmerc-www.bu.edu/psa/. Accessed May 10, 2004

Correspondence

CME
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s “Cited By” API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Comment

Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 18

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Topics
PubMed Articles